Unstained 4 µm thick sections of formalin fixed paraffin embedded liver biopsies were transferred from glass slides to 1.5 ml non-siliconized microcentrifuge tubes containing 200µl of TRIzol (Gibco BRL, Gaithersburg MD), tapped thoroughly to immerse the tissue section and warmed to 65°C for ten minutes, then placed on ice for one minute. Ten µg of E. coli tRNA and 20µl of chloroform were added, and after mixing the tubes were incubated for 3 minutes at room temperature. The samples were spun in a countertop centrifuge at 4°C for 15 minutes, and 100µl of the clear aqueous upper phase was transferred to a new microcentrifuge tube. After addition of 100µl of isoproponal the tubes were incubated for 10 minutes at room temperature, then centrifuged 12,000 rpm at 4°C for 10 minutes. The supernatant was carefully decanted and the RNA pellet was washed with 100µl of 75% ethanol. The pellets were dried under vacuum (without centrifugation or heat) for 5 minutes to less than dryness, then resuspended in 50µl of ddH2O.
"Multiplex" amplification was performed for the 5'' non-coding region of the hepatitis C RNA genome[1] as well as albumin mRNA to demonstrate successful extraction of RNA and subsequent RT-PCR using primers to span two introns.[2]
GGCGACACTCCACCATAGATCA (upstream) GGTTCCGCAGACCACTATGGC (downstream)
GCTGCTTTTACAGAATGTTGCCAA (upstream) ACTTCTGCAAACTCAGCTTTGGG (downstream)
CTCCCCTGTGAGGAACTAC (upstream) GGTCCTGGAGGCTGCACA (downstream)
ATAAAGCTGCCTGCCTGTTG (upstream) AATCTCTGGCTCAGGCGAG (downstream)
RT-PCR is performed with 23 µl of the extracted material from each slide in a final 50 µl reaction mix containing 200 µM of each dNTP, 2.5 ng/µl (approximately 380 nM) of each first round primer, 2.5u of Taq polymerase, 1X Taq polymerase buffer, 4 mM MgCl2, 0.5µl (12.5u) of RT AMV (12.5u) and 1µl (40u) RNase inhibitor (both from Boehringer Mannheim, Indianapolis IN) using an initial 30 minute reverse transcriptase incubation at 42°C and 3 minute denaturation step followed by 35 cycles of PCR consisting of one minute at 94°C (denaturation), two minutes at 62°C (annealing), and two minutes at 72°C (extension) with a final 10 minute completion step at 72°C.
Ten percent (5 µl) of the PCR product is then transferred to a second round reaction mix with second round primers for hepatitis C and albumin mRNA and reagents in the same concentrations as above except for 1.5 mM MgCl2. PCR cycling conditions are as for first round amplification except for an annealing temperature of 54°C. The resulting PCR product can be resolved by electrophoresis through an agarose gel and directly visualized with ethidium bromide staining and ultraviolet illumination. The lengths of the nested PCR products are 82 bp (hepatitis C) and 151 bp (albumin).
In a comparative analysis, this RT-PCR protocol was positive in 48 of 49 biopsies from patients with circulating anti-hepatitis C antibodies, and no examples of false-positive amplification were seen in 23 negative controls liver biopsies. In contrast, 53% of liver biopsies with documented hepatitis C infection were negative with immunohistochemistry using TORDJI-22.
[1.] Kato N, Hijikata M, Ootsuyama Y, Nakagawa M, Ohkoshi S, Sugimura T, Shimotohno K: Molecular cloning of the human hepatitis C virus genome from Japanese patients with non-A, non-B hepatitis. Proc. Natl. Acad. Sci USA 87:9524, 1990
[2.]McDonnell MW, Scheiman JJM, Traber PG: Induction of Cytochrome P450IA Genes (CYP1A) by Omeprazole in the Human Alimentary Tract. Gastroenterology 103:1509, 1992.
[3.]Svoboda-Newman SM, Greenson JK, Singleton TP, Sun R, Frank TS: Detection of hepatitis C in paraffin sections of formalin fixed liver using RT-PCR. Modern Pathology, 9 (1):137A, 1996.
首页
