Cycle Sequence Reactions For Large Insert Plasmid Templates

The following dye-labeled terminator reaction chemistries have been designed to balance conservation of reagents with the resulting sequence product signal strength.  When coupled with BACPAC Resource template preparation, N-free read lengths of >400nts can be expected.  More emphasis can be placed on reagent conservation by further volume reduction or dilution; or on sequence product signal strength by increasing the reaction size.

Cycle Sequence Chemistry Conditions:

 
CycleSequenceConditions:
1)    Initial denaturation step:  96oC 4min.
2)                    denaturation:  96oC 10sec.
3)                        annealing:  50oC 10sec.
4)                        extension:  60oC 4min. run steps 2-4 for 100 cycles.
5)                                hold:  4-10oC.
Primers Useful For BAC and PAC Vectors:
T7.29:     5’    gccgctaatacgactcactatagggagag    29mer
T7:          5’    taatacgactcactataggg     20mer
gSP6:       5’    gttttttgcgatctgccgtttc     22mer
					

³Stock ABI Ready Reaction mixes are supplemented with 4mM MgCl2
⁴Refers to ABI 1x (20ul) reaction 
⁵Annealing temp can be adjusted, based on Tm of primers used