The following dye-labeled terminator reaction chemistries have been designed to balance conservation of reagents with the resulting sequence product signal strength. When coupled with BACPAC Resource template preparation, N-free read lengths of >400nts can be expected. More emphasis can be placed on reagent conservation by further volume reduction or dilution; or on sequence product signal strength by increasing the reaction size.
Cycle Sequence Chemistry Conditions:
Chemistry3 | Reaction Size4 | Final Vol (ul) | Primer Vol (10pmol/ul) | Reaction Mix vol (ul) | Template vol (ul) |
ABI dRhod term | 1.25x | 25 | 1 | 10 | 14 |
ABI BD term | 0.75x | 15 | 1 | 6 | 8 |
CycleSequenceConditions:
1) Initial denaturation step: 96oC 4min.
2) denaturation: 96oC 10sec.
3) annealing: 50oC 10sec.
4) extension: 60oC 4min. run steps 2-4 for 100 cycles.
5) hold: 4-10oC.
Primers Useful For BAC and PAC Vectors:
T7.29: 5’ gccgctaatacgactcactatagggagag 29mer
T7: 5’ taatacgactcactataggg 20mer
gSP6: 5’ gttttttgcgatctgccgtttc 22mer
3Stock ABI Ready Reaction mixes are supplemented with 4mM MgCl2
4Refers to ABI 1x (20ul) reaction
5Annealing temp can be adjusted, based on Tm of primers used