9. Gel purification of cDNA
1) Spin down and wash the samples (see 8.1), then resuspend the pellets in water (6 μl)
2) Add 2x TBE-urea loading buffer (6 μl) and heat samples to 80°C for 3 min directly before loading on a precast 6% TBE-urea gel. Also load a low molecular weight marker for subsequent cutting (see below)
3) Run the gel for 40 min at 180 V depending on manufacturer’s
instructions. This leads to a reproducible migration pattern of cDNAs
and dyes (light and dark blue) in the gel
4) Use a razor blade to cut (red line) three bands of cDNA fractions at 120-200 nt (high (H)), 85-120 nt (medium (M)) and 70-85 nt (low (L)). Start by cutting in the middle of the light blue dye, divide the medium and low fractions and trim the high and low fractions. Use vertical cuts guided by the pockets and the dye to separate the different lanes (in this example 1-4). The marker lane (m) can be stained and imaged to control sizes after the cutting. Fragment sizes are indicated on the right
5) Add TE (400 μl) and crush the gel slice into small pieces using a 1 ml syringe plunger. Incubate shaking at 1,100 rpm for 2 h at 37°C
6) Place two 1 cm glass pre-filters into a Costar SpinX column and transfer the liquid portion of the sample to the column. Spin for 1 min at 13,000 rpm into a 1.5 ml tube
7) Add glycoblue (0.5 μl) and sodium acetate pH 5.5 (40 μl), then mix the sample. Add 100% ethanol (1 ml), mix again and precipitate over night at -20°C
10. Ligation of primer to the 5'end of the cDNA
1) Spin down and wash the samples (see 8.1), then resuspend pellets in ligation mix B (8 μl) and incubate for 1 h at 60°C
2) Add oligo annealing mix (30 μl) and incubate for 1 min at 95°C. Then decrease the temperature every 20 sec by 1°C until 25°C are reached
3) Add BamHI (2 μl) and incubate for 30 min at 37°C
4) Add TE (50 μl) and glycoblue (0.5 μl) and mix. Add sodium acetate pH 5.5 (10 μl) and mix, then add 100% ethanol (250 μl) and mix again, then precipitate over night at -20°C
*Avoid contamination with PCR products from previous experiments by spatially separating pre- and post-PCR steps. Ideally, analysis of PCR products and all subsequent steps should be performed in a separate room.
11. PCR amplification
1) Spin down and wash the samples (see 8.1), then resuspend the pellet in water (19 μl)
2) Prepare the PCR mix and run PCR programme: 94°C for 2 min, [94°C for 15 sec, 65°C for 30 sec, 68°C for 30 sec]25-35 cycles, 68°C for 3 min, 4°C for ever
*The primer sequences used are for solexa sequencing, other systems may require adjustment of the primers.
3) Mix PCR product (8 μl) with 5x TBE loading buffer (2 μl) and load on a precast 6% TBE gel. Stain the gel with Sybrgreen I and analyse the PCR products with a gel imager; this allows monitoring of the success of the experiment prior to sequencing of the iCLIP library
4) The gel image of the PCR products should show a size range that corresponds to the cDNA fraction (high, medium or low) purified in step 9.4
*Note that the PCR primers P3Solexa and P5Solexa introduce an additional 76 nt to the size of the cDNA. Primer dimer product can appear at about 140 nt.
5) The barcode in the Rclip primers allow to multiplex different samples before submitting for high throughput solexa sequencing
6) Submit 15 μl of the library for sequencing and store the rest
*Control experiments should give no products after PCR amplification, and high-throughput sequencing of control libraries should return very few unique sequences
12. Linker and primer sequences
1) Pre-adenylated 3' linker DNA (aliquots of 20 μM of the DNA adapter):
L3 /5rApp/AGATCGGAAGAGCGGTTCAG/3ddC/
2) Rclip reverse transcriptase primers with different barcodes (desalted and not gel-purified):
3) X33 = 5’ phosphate
4) Cut_oligo: GTTCAGGATCCACGACGCTCTTCaaaa
5) P5Solexa: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
6) P3Solexa: CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
References:
1. Konig, J., Zarnack, K., Rot, G., Curk, T., Kayikci, M. ., Zupan, B., Turner, D. J., Luscombe, N. M., Ule, J. “iCLIP - Transcriptome-wide Mapping of Protein-RNA Interactions with Individual Nucleotide Resolution.” J. Vis. Exp. (50), e2638, DOI: 10.3791/2638 (2011).
首页
